RIKEN DNA Bank Human Resource

RIKEN DNA Bank Human Resource - CHST3

Gene ID	NCBI Gene 9469 \| KEGG hsa:9469
Gene Symbol	CHST3
Protein Name	carbohydrate sulfotransferase 3
Synonyms	C6ST\|C6ST1\|HSD

Ortholog resource in our bank

  CHST3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number	Clone name	Vector	CDS comparison
	Clone name	Vector	Refered mRNA⁽¹⁾	CDS status
	5'-terminal sequence⁽²⁾
HKR081660	ARf04C12	pKA1U5	NM_004273.3	VA
HKR081660	ATCCTGGAGGACCTCTCGCAGGCTCGCTGCGCAGGACGGCGCCCGCCTGGCGCCGCTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl