Prev. |  KEGG KO K01020 > 

RIKEN DNA Bank Human Resource - CHST3

Gene ID NCBI Gene 9469 |  KEGG hsa:9469
Gene Symbol CHST3
Protein Name carbohydrate sulfotransferase 3
Synonyms C6ST|C6ST1|HSD
Ortholog resource in our bank

  CHST3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR081660 ARf04C12 pKA1U5 NM_004273.3 done
ATCCTGGAGGACCTCTCGCAGGCTCGCTGCGCAGGACGGCGCCCGCCTGGCGCCGCTTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv


2022.04.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl