Prev. |  KEGG KO K00799 > 

RIKEN DNA Bank Human Resource - GSTO1

Gene ID NCBI Gene 9446 |  KEGG hsa:9446
Gene Symbol GSTO1
Protein Name glutathione S-transferase omega 1
Synonyms GSTO 1-1|GSTTLp28|HEL-S-21|P28|SPG-R
Ortholog resources KEGG ortholog (KEGG orthology K00799) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082505 IRAL006E09 pOTB7 BC000127 NM_004832 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044028 ARe10B04 pKA1U5 NM_004832.1  
TGGAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGG
HKR048577 ARe21H09 pKA1U5 NM_004832.1  
GGCAAACCCCAGAGGAGCTCGGCCTGCGCTGCNCCANGATGTCCGGGGAGTCAGCCAGGA
HKR048948 ARe22G04 pKA1U5 NM_004832.1  
GAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGGGA
HKR050106 ARe25E10 pKA1U5 NM_004832.1  
TGACTTCCTGAATCCCCTGCNAACCCCAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTC
HKR053752 ARe34G08 pKA1U5 NM_004832.1  
GGCGCCACGATGTTCCGGGGAGTCAGCCAGGAGCTTGGGGAAGGGAAGCGCGCCCCCGGG
HKR186473 ARi66D01 pGCAP10 NM_004832.1  
GCCCCTGCAAACCCCAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGNGAGTCAGC
HKR208118 ARiS020E22 pGCAP10 NM_004832.1  
GAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGGGA
HKR208271 ARiS020L07 pGCAP10 NM_004832.1  
GACTTCCTGAATCCCCTGCAAACCCCAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCC
HKR222118 ARiS055E22 pGCAP10 NM_004832.1  
GANANGAGCTCNGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGANCTTGNNGA
HKR235208 ARiS088A08 pGCAP10 NM_004832.1  
GCCTGCAAACCCCAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCA
HKR327659 RBb19C11 pKA1U5 NM_004832.1  
GGTCCGGGGAGTCAGCCAGGAGCTTGGGGAAGGGAAGCGCGCCCCCGGGGCCGGTCCCGG
HKR343308 RBb58E12 pGCAP1 NM_004832.1  
AAACCCCAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCT
HKR344477 RBb61D05 pGCAP1 NM_004832.1  
TAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGGGA
HKR381754 RBd54G10 pGCAP10 NM_004832.1  
GGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGGGAAGGNNNNNNCGCCCCCGGGGCC
HKR433273 RBdS083D01 pGCAP10 NM_004832.1  
GAGAGGAGCTCGGCCTGCGCTGCGCCACGATGTCCGGGGAGTCAGCCAGGAGCTTGGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl