Prev. |  KEGG KO K00653 > 

RIKEN DNA Bank Human Resource - CDYL

Gene ID NCBI Gene 9425 |  KEGG hsa:9425
Gene Symbol CDYL
Protein Name chromodomain Y like
Synonyms CDYL1
Ortholog resources KEGG ortholog (KEGG orthology K00653) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX035852 IRAK089K12 pCMV-SPORT6 BC043397 NM_170752 Full
HGX056627 IRAK141J11 pCMV-SPORT6 BC061516 NM_170752 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR022076 ARa55D04 pKA1U5 NM_004824.3  
GACTACACCGCGNANAAGGGAGCCCCGTATCCNNGCCGCGCCCGTNNCGACACNCCGCCG
HKR378978 RBd47H10 pGCAP10 NM_004824.3  
GGCGCGGCTCCGCAGGGCCGGGCGGCCGCACTGGGCATGCTCAGTAGCCGGGGCAGGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl