Prev. | 

RIKEN DNA Bank Human Resource - CRIPT

Gene ID NCBI Gene 9419 |  KEGG hsa:9419
Gene Symbol CRIPT
Protein Name CXXC repeat containing interactor of PDZ3 domain
Synonyms HSPC139|SSMDF
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086561 IRAL016G17 pDNR-LIB BC006980 NM_014171 Full
HGY093054 IRAL032K14 pDNR-LIB BC018653 NM_014171 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE096412 M01C041A12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096460 M01C041C12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096508 M01C041E12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096556 M01C041G12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096604 M01C041I12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096652 M01C041K12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096700 M01C041M12 pDONR221 MGC10-B06 BC006980 NM_014171  
HGE096748 M01C041O12 pDONR221 MGC10-B06 BC006980 NM_014171  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR398875 RBd97D03 pGCAP10 NM_014171.4  
GGCGGCTAGGGGAACCGTCGTGGGGAAGGATGGTGTGCGAAAAATGTGAAAAGAAACTTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl