Prev. |  KEGG KO K12858 > 

RIKEN DNA Bank Human Resource - DDX23

Gene ID NCBI Gene 9416 |  KEGG hsa:9416
Gene Symbol DDX23
Protein Name DEAD-box helicase 23
Synonyms PRPF28|SNRNP100|U5-100K|U5-100KD|prp28
Ortholog resource in our bank

  DDX23

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080495 IRAL001D23 pOTB7 BC002366 NM_004818 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099622 M01C049A22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099670 M01C049C22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099718 M01C049E22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099766 M01C049G22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099814 M01C049I22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099862 M01C049K22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099910 M01C049M22 pDONR221 MGC14-B11 BC002366 NM_004818  
HGE099958 M01C049O22 pDONR221 MGC14-B11 BC002366 NM_004818  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR428174 RBdS070H06 pGCAP10 NM_004818.2  
GAAACGGGAAAGATGGCGACGGCTCCGCGACGTTGAGGCCGCGTTGGGCGGTTCAGACTC
HKR462668 RBdS156L04 pGCAP10 NM_004818.2  
GATCNNCGCGACCAGGAAACGGGAAAGATGGCGACGGCTCCGCGACGTTGAGGCCGCGTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl