Prev. |  KEGG KO K10226 > 

RIKEN DNA Bank Human Resource - FADS2

Gene ID NCBI Gene 9415 |  KEGG hsa:9415
Gene Symbol FADS2
Protein Name fatty acid desaturase 2
Synonyms D6D|DES6|FADSD6|LLCDL2|SLL0262|TU13
Ortholog resources KEGG ortholog (KEGG orthology K10226) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005047 IRAK012K07 pCMV-SPORT6 BC009011 NM_004265 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR058949 ARe47G05 pKA1U5 NM_004265.2  
ACTGGAGGCAAAAGTCCATAGCGGGAGGGCTGACGNTAGGGGCGGAGGAAGGGGACCGCT
HKR068883 ARe72D11 pKA1U5 NM_004265.2  
GACTCCCCAGACTCCACTTCTCCAGGCCTCTCTCCCGCCTTTTCATCCCGCATCCGCAGG
HKR078126 ARe95F06 pKA1U5 NM_004265.2  
GGGGGGGAGCCGGAGGGGCGGGCAGAGGAGGTGTCTAGGCCCTGAGCTCCCGGGGAGTTT
HKR164459 ARi11C11 pGCAP10 NM_004265.2  
GGTTGTTGGCCTCCATCCCCACTCCCCAGACTCCACTTCTCCAGGCCTCTCTCCCGCCTT
HKR247557 ARiS118O21 pGCAP10 NM_004265.2  
TAAAGCCGAAAGCGAAGAGGGCCCGGGCTGCACACACCGGCTGGGAGGCAGCCGTCTGTG
HKR346530 RBb66F10 pGCAP1 NM_004265.2  
GGCTGCACACACCGGCTGGGAGGCAGCCGTCTGTGCAGCGAGCAGCCGGCGCGGGGAGGC
HKR362499 RBd06E03 pGCAP10 NM_004265.2  
GTGCACACACCGGCTGGGAGGCAGCCGTCTGTGCAGCGAGCAGCCGGCGCGGGGAGGCCG
HKR397628 RBd94B04 pGCAP10 NM_004265.2  
CGGCCGGCCGATCTGCTGCACACACCGGCTGGGAGGCAGCCGTCTGTGCAGCGAGCAGCC
HKR420569 RBdS051H01 pGCAP10 NM_004265.2  
GCTCCGCCAGGAAGGCAGGGACACTCCCGAGCGCAGGCGAGAAGGCTGGGGGAGGGGGCG
HKR471030 RBdS177J14 pGCAP10 NM_004265.2  
GGCACACACCGGCTGGGAGGCAGCCGTCTGTGCAGCGAGCAGCCGGCGCGGGGAGGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl