Prev. | 

RIKEN DNA Bank Human Resource - ZRANB2

Gene ID NCBI Gene 9406 |  KEGG hsa:9406
Gene Symbol ZRANB2
Protein Name zinc finger RANBP2-type containing 2
Synonyms ZIS|ZIS1|ZIS2|ZNF265
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033977 IRAK084P17 pCMV-SPORT6 BC039814 NM_005455 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024857 W01A062C09 pENTR-TOPO IRAK084P17 BC039814 NM_005455  
HGE024859 W01A062C11 pENTR-TOPO IRAK084P17 BC039814 NM_005455  
HGE024861 W01A062C13 pENTR-TOPO IRAK084P17 BC039814 NM_005455  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070973 ARe77H05 pKA1U5 NM_203350.1  
TTATAAAACAGCTTTGACTTGAAAAAAAAAAACCCCNNAAAAAAAAAAAAAAAAAAAAAA
HKR177721 ARi44F01 pGCAP10 NM_203350.1  
GGGCTGTGCTGGTGGCGNTCNAGATGTCGACCAAGAATTTCCNAGTCAGTGACGGGGACT
HKR333274 RBb33D02 pGCAP1 NM_203350.1  
GGAAGACATAGCTGCGGGTGGCTGTGCTGGTGGCGTTCAAGATGTCGACCAAGAATTTCC
HKR430197 RBdS075I05 pGCAP10 NM_203350.1  
TGGTGGCGTTCAAGATGTCGACCAAGAATTTCCGAGTCAGTGACGGGGACTGGATTTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl