Prev. |  KEGG KO K20288 > 

RIKEN DNA Bank Human Resource - COG1

Gene ID NCBI Gene 9382 |  KEGG hsa:9382
Gene Symbol COG1
Protein Name component of oligomeric golgi complex 1
Synonyms CDG2G|LDLB
Ortholog resource in our bank

  COG1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY081015 IRAL002I23 pOTB7 BC021985 NM_018714 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099636 M01C049B12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099684 M01C049D12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099732 M01C049F12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099780 M01C049H12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099828 M01C049J12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099876 M01C049L12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099924 M01C049N12 pDONR221 MGC14-D06 BC021985 NM_018714  
HGE099972 M01C049P12 pDONR221 MGC14-D06 BC021985 NM_018714  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR366171 RBd15H03 pGCAP10 NM_018714.2  
GATGGCCACCGCGGCAACCTCACCCGCGCTGAAGCGGCTGGATCTGCGCGACCCTGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl