Prev. |  KEGG KO K00049 > 

RIKEN DNA Bank Human Resource - GRHPR

Gene ID NCBI Gene 9380 |  KEGG hsa:9380
Gene Symbol GRHPR
Protein Name glyoxylate and hydroxypyruvate reductase
Synonyms GLXR|GLYD|PH2
Ortholog resource in our bank

  GRHPR

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082120 IRAL005E24 pOTB7 BC000605 NM_012203 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE014653 W01A036K13 pENTR-TOPO IRAL005E24 BC000605 NM_012203  
HGE014655 W01A036K15 pENTR-TOPO IRAL005E24 BC000605 NM_012203  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR056922 ARe42F02 pKA1U5 NM_012203.1  
TGGGCCCCGGCCCAGCTACATTCCCGGGCCAGCTTCTGTACTGCCAGGTCCGGGTCGGCG
HKR187254 ARi68C06 pGCAP10 NM_012203.1  
GATTCCCGGGCCAGCTTCTGTACTGCCAGGTCCGGGTCGGCGGCTGCACTGCGGATGAGA
HKR374101 RBd35E05 pGCAP10 NM_012203.1  
GAGCTTCTGTACTGCCAGGTCCGGGTCGGCGGCTGCACTGCGGATGAGACCGGTGCGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl