Prev. |  KEGG KO K02264 > 

RIKEN DNA Bank Human Resource - COX5A

Gene ID NCBI Gene 9377 |  KEGG hsa:9377
Gene Symbol COX5A
Protein Name cytochrome c oxidase subunit 5A
Synonyms COX|COX-VA|VA
Ortholog resources KEGG ortholog (KEGG orthology K02264) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY018520 IRAK046E24 pBluescriptR BC024240 NM_004255 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR042125 ARe05F05 pKA1U5 NM_004255.3  
GGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGC
HKR044129 ARe10F09 pKA1U5 NM_004255.3  
GGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGC
HKR044408 ARe11A08 pKA1U5 NM_004255.3  
TGGTCCGCCCGCTGTGAGCCTGTCCGGCCCCCGCCCGCTCCGGAGCAACCCGCGAGCTTA
HKR056925 ARe42F05 pKA1U5 NM_004255.3  
GGTCCTCAGCCCGCGCGCCGCCATCGCCGTTCATGCTGGGCGCCGCTCTCCGCCGCTGCG
HKR065203 ARe63A03 pKA1U5 NM_004255.3  
TGGCTCCGGAGCAACCCGCGAGCTTACACCGGCTTCTCTCTGTCCTCAGCCCGCGCGCCG
HKR164103 ARi10E07 pGCAP10 NM_004255.3  
TGGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGGCCGCAACCACCCGGGCCGACCCTCGA
HKR175353 ARi38G09 pGCAP10 NM_004255.3  
GGTGAGCCTGTCCGGCCCCCGCCCGCTCCGGAGCAACCCGCGAGCTTACACCGGCTTCTC
HKR182454 ARi56C06 pGCAP10 NM_004255.3  
GGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGGCCGCAA
HKR186170 ARi65H02 pGCAP10 NM_004255.3  
GCTCTGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCT
HKR277756 ARiS194G12 pGCAP10 NM_004255.3  
GGCGCGCCNCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGGCCGCAA
HKR337775 RBb44H07 pGCAP1 NM_004255.3  
TTTTTTTTTTTTGAGAGTCGCAGTGGGCGGGCCTACGTGCTCCGCCCGCTGTGAGCCTGT
HKR368874 RBd22D02 pGCAP10 NM_004255.3  
GGTGAGCCTGTCCGGCCCCCGCCCGCTCCGGAGCAACCCGCGAGCTTACACCGGCTTCTC
HKR370011 RBd25A11 pGCAP10 NM_004255.3  
GGGCTTCTCTCTGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTC
HKR390902 RBd77E06 pGCAP10 NM_004255.3  
GGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGCTGTGGCC
HKR416020 RBdS040A20 pGCAP10 NM_004255.3  
GGGCTTCTCTCTGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTC
HKR430190 RBdS075H22 pGCAP10 NM_004255.3  
GGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGC
HKR453101 RBdS132M13 pGCAP10 NM_004255.3  
GGTCCTCAGCCCGCGCGCCGCCATCGCCGTCATGCTGGGCGCCGCTCTCCGCCGCTGCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl