Prev. |  KEGG KO K20196 > 

RIKEN DNA Bank Human Resource - KIF3B

Gene ID NCBI Gene 9371 |  KEGG hsa:9371
Gene Symbol KIF3B
Protein Name kinesin family member 3B
Synonyms FLA8|HH0048|KLP-11
Ortholog resource in our bank

  KIF3B

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04611 SEREX clone NGO-Br-17 (ID 822, 823) #1 SEREX clone NGO-Br-17 (ID 822, 823) #1

webcatalog20220516.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR053327 ARe33F07 pKA1U5 NM_004798.4 full/var done
ATCCTGCTCTCTCCCCATCCGGGGCAGCGGGGAATGGCTGAGCCAGGGGTTCGCCGCCCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023Apr25.csv
NRCDhumcloneList_RB_2023Apr25.csv


2023.05.04

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl