Prev. |  KEGG KO K08509 > 

RIKEN DNA Bank Human Resource - SNAP29

Gene ID NCBI Gene 9342 |  KEGG hsa:9342
Gene Symbol SNAP29
Protein Name synaptosome associated protein 29
Synonyms CEDNIK|SNAP-29
Ortholog resource in our bank

  SNAP29

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB19638 pMRX-IP-GFP-SNAP29 Retroviral vector for stable expression of human SNAP29 with N-terminal EGFP.
RDB19765 p3xFLAG-CMV10-SNAP29 Transient expression vector of human SNAP29 with N-terminal FLAG.

webcatalog20220516.tab


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005929 IRAK014N17 pCMV-SPORT6 BC009715 NM_004782 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE040572 W01A101H04 pENTR-TOPO IRAK014N17 BC009715 NM_004782  
HGE040582 W01A101H14 pENTR-TOPO IRAK014N17 BC009715 NM_004782  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219820 ARiS049J04 pGCAP10 NM_004782.3  
TGTTTCCCAGACTGAGAGCCGCGCCGGCACCATGTCAGCTTACCCTAAGAGCTACAATCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.26

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl