Prev. | 

RIKEN DNA Bank Human Resource - TCEAL1

Gene ID NCBI Gene 9338 |  KEGG hsa:9338
Gene Symbol TCEAL1
Protein Name transcription elongation factor A like 1
Synonyms SIIR|WEX9|p21|pp21
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001665 IRAK004C17 pCMV-SPORT6 BC000809 NM_004780 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE000602 W01A001I10 pENTR-TOPO IRAK004C17 BC000809 NM_004780  
HGE000606 W01A001I14 pENTR-TOPO IRAK004C17 BC000809 NM_004780  
HGE000608 W01A001I16 pENTR-TOPO IRAK004C17 BC000809 NM_004780  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043701 ARe09E05 pKA1U5 NM_004780.2  
GGTCTGTGTGCAGGTCTGCTGGTCACAGCGGGGCACCTCGAGGAGAGGACGACTAGGAGC
HKR074555 ARe86G11 pKA1U5 NM_004780.2  
GGTCTTGCGTCTGTGTGCAGGTCTGCTGGTCACAGCGGGGCACCTCGAGGAGAGGACGAC
HKR185206 ARi63A06 pGCAP10 NM_004780.2  
GGGGAAGGAGGGGGCGACCGGGAAGCGGCGGAGTCGGGAGAGCCGGAGAGCCTCTGGGAA
HKR338098 RBb45E02 pGCAP1 NM_004780.2  
GGGGAAAATGGTGGGCTTTCGGGAAGGAGGGGGCGACCGGGAAGCGGCGGAGTCGGGAGA
HKR416165 RBdS040G21 pGCAP10 NM_004780.2  
GACAGCGGGGCACCTCGAGGAGAGGACGACTAGGAGCACACGGCCCGGAAAGGTCCAGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl