Prev. |  KEGG KO K15201 > 

RIKEN DNA Bank Human Resource - GTF3C3

Gene ID NCBI Gene 9330 |  KEGG hsa:9330
Gene Symbol GTF3C3
Protein Name general transcription factor IIIC subunit 3
Synonyms TFIIIC102|TFIIICgamma|TFiiiC2-102
Ortholog resource in our bank

  GTF3C3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX035683 IRAK089D11 pCMV-SPORT6 BC043347 NM_012086 Full/var
HGY095214 IRAL038A14 pDNR-LIB BC015995 NM_012086 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE003202 W01A008A02 pENTR-TOPO IRAK089D11 BC043347 NM_012086  
HGE003208 W01A008A08 pENTR-TOPO IRAK089D11 BC043347 NM_012086  
HGE003210 W01A008A10 pENTR-TOPO IRAK089D11 BC043347 NM_012086  
HGE003214 W01A008A14 pENTR-TOPO IRAK089D11 BC043347 NM_012086  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR334431 RBb36B07 pGCAP1 NM_012086.2  
TGGCTCTGTCCCGGTTCCTGGGGTTGCACAGACAGACCCTGCTAAACATGTCAGGGTTCA
HKR444194 RBdS110I02 pGCAP10 NM_012086.2  
GCTTCCGGTTCTCTGTCCCGGTTCCTGGGGTTGCACAGACAGACCCTGTAAACATGTCAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl