Prev. |  KEGG KO K15202 > 

RIKEN DNA Bank Human Resource - GTF3C5

Gene ID NCBI Gene 9328 |  KEGG hsa:9328
Gene Symbol GTF3C5
Protein Name general transcription factor IIIC subunit 5
Synonyms TFIIIC63|TFIIICepsilon|TFiiiC2-63
Ortholog resources KEGG ortholog (KEGG orthology K15202) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY095771 IRAL039H03 pOTB7 BC017337 NM_012087 Full/var
HGY085726 IRAL014F06 pOTB7 BC009741 NM_012087 Partial/var
HGY095677 IRAL039D05 pOTB7 BC030157 NM_012087 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE002465 W01A006C17 pENTR-TOPO IRAL039H03 BC017337 NM_012087  
HGE002467 W01A006C19 pENTR-TOPO IRAL039H03 BC017337 NM_012087  
HGE002471 W01A006C23 pENTR-TOPO IRAL039H03 BC017337 NM_012087  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR441746 RBdS104G02 pGCAP10 NM_012087.3  
GGCCAGACGCACAGGGATGGCGGCGGAGGCGGCCGATTTGGGGCTGGGGGCCGCCGTCCC
HKR444283 RBdS110L19 pGCAP10 NM_012087.3  
CGGCCGGCCGATGAGACGCACAGGGATGGCGGCGGAGGCGGCCGATTTGGGGCTGGGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl