Prev. | 

RIKEN DNA Bank Human Resource - ZNHIT3

Gene ID NCBI Gene 9326 |  KEGG hsa:9326
Gene Symbol ZNHIT3
Protein Name zinc finger HIT-type containing 3
Synonyms PEHO|TRIP3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY094626 IRAL036J10 pDNR-LIB BC017931 NM_001033577 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE028362 W01A070P02 pENTR-TOPO IRAL036J10 BC017931 NM_001033577  
HGE028364 W01A070P04 pENTR-TOPO IRAL036J10 BC017931 NM_001033577  
HGE028366 W01A070P06 pENTR-TOPO IRAL036J10 BC017931 NM_001033577  
HGE028372 W01A070P12 pENTR-TOPO IRAL036J10 BC017931 NM_001033577  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR384146 RBd60G02 pGCAP10 NM_004773.2  
GAGTCTCCTTCCACAAAACCATGGCGTCGCTCAAATGTAGCACCGTCGTCTGCGTGATCT
HKR409079 RBdS022L15 pGCAP10 NM_004773.2  
GAAACAGTCTCCTTCCACAAAACCATGGCGTCGCTCAAATGTAGCACCGTCGTCTGCGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl