Prev. |  KEGG KO K11301 > 

RIKEN DNA Bank Human Resource - HMGN3

Gene ID NCBI Gene 9324 |  KEGG hsa:9324
Gene Symbol HMGN3
Protein Name high mobility group nucleosomal binding domain 3
Synonyms PNAS-24|PNAS-25|TRIP7
Ortholog resources KEGG ortholog (KEGG orthology K11301) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005704 IRAK014E08 pCMV-SPORT6 BC009529 NM_138730 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR069771 ARe74H03 pKA1U5 NM_004242.2  
TGGCTCTCTGCTCTCGCGGCCGACTCGCAAGATGGCGCCGCAGAAAGACAGGAAGCCCAA
HKR170001 ARi25A01 pGCAP10 NM_004242.2  
GGAAGAGGCCGGGCTACGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCAT
HKR171701 ARi29E05 pGCAP10 NM_004242.2  
CGGCCGGCCGATGGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCATCCAGCGG
HKR172435 ARi31B11 pGCAP10 NM_004242.2  
GGGCAGAGGCAGCATCCAGCGGCGGCGCCAGCAGTTCCAGTCCGTTGCTTTACTTTTTGC
HKR326452 RBb16C04 pKA1U5 NM_004242.2  
TAAAAGGAGGCCGGGCTACGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGC
HKR334804 RBb37A04 pGCAP1 NM_004242.2  
GGGCAGAGGCAGCATCCAGCGGCGGCGCCAGCAGTTCCAGTCCGTTGCTTTACTTTTTGC
HKR336027 RBb40B03 pGCAP1 NM_004242.2  
GGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCATCCAGCGGCGGCGCCAGCAGTTCCAGT
HKR362460 RBd06C12 pGCAP10 NM_004242.2  
GGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCATCCAGCGGCGGCGCCAGCAGTTCCAGT
HKR367323 RBd18F03 pGCAP10 NM_004242.2  
GGAGGCCGGGCTACGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCATCCA
HKR377649 RBd44C01 pGCAP10 NM_004242.2  
GGGGCTACGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCATCCAGCGGCG
HKR382811 RBd57A11 pGCAP10 NM_004242.2  
GCGGGCTAAGACGNNNNCTGCGCGNGAGCAGNTGCNGCGNNNNNTNNAGCATCCAGCGGC
HKR394145 RBd85G01 pGCAP10 NM_004242.2  
GAGCCGCGGAGGTGCAGGTCGAAGAGGCCGGGCTACGTCGTGCCCTGCGCGTGAGCAGCT
HKR444213 RBdS110I21 pGCAP10 NM_004242.2  
GGAAGAGGCCGGGCTACGTCGTGCCCTGCGCGTGAGCAGCTGCAGCGGCAGAGGCAGCAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl