Prev. |  KEGG KO K07196 > 

RIKEN DNA Bank Human Resource - TRIP10

Gene ID NCBI Gene 9322 |  KEGG hsa:9322
Gene Symbol TRIP10
Protein Name thyroid hormone receptor interactor 10
Synonyms CIP4|HSTP|STOT|STP|TRIP-10
Ortholog resource in our bank

  TRIP10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY084433 IRAL011B09 pOTB7 BC013002 NM_004240 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR219890 ARiS049M02 pGCAP10 NM_004240.2  
TGGAGTCTCCCCGGGGAGGGCGGCGGGCGGCGGGCGGCGGGGACCGGGTGCGGTGGTGGC
HKR366826 RBd17B02 pGCAP10 NM_004240.2  
GGGGGAGGGCGGCGGGCGGCGGGCGGCGGGGACCGGGTGCGGTGGTGGCTGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl