Prev. | 

RIKEN DNA Bank Human Resource - TRIP13

Gene ID NCBI Gene 9319 |  KEGG hsa:9319
Gene Symbol TRIP13
Protein Name thyroid hormone receptor interactor 13
Synonyms 16E1BP|MVA3
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080644 IRAL001K04 pOTB7 BC000404 NM_004237 Full
HGY083650 IRAL009C02 pOTB7 BC019294 NM_004237

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE001678 W01A004D06 pENTR-TOPO IRAL001K04 BC000404 NM_004237  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR047655 ARe19C07 pKA1U5 NM_004237.2  
GGGTGCGCCTCGCGCGGCAGATTCGAAGCTAGGGCGGGGCCCGCGGGCTGAGGCAGCGGC
HKR234063 ARiS085C15 pGCAP10 NM_004237.2  
GAGGCAGCGGCTGTGGCGGCGACGCTGGGCGTGAGGTGGCGGCGGCCGCGCCCTGGTTGG
HKR323374 RBb08H06 pKA1U5 NM_004237.2  
GCCGGGTCAGGAGGTGGTGCGCCTCGCGCGGCAGATTCGAAGCTAGGGCGGGGCCCGCGG
HKR342545 RBb56G01 pGCAP1 NM_004237.2  
GGCCCGCGGGCTGAGGCAGCGGCTGTGGCGGCGACGCTGGGCGTGAGGTGGCGGCGGCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl