Prev. |  KEGG KO K12176 > 

RIKEN DNA Bank Human Resource - COPS2

Gene ID NCBI Gene 9318 |  KEGG hsa:9318
Gene Symbol COPS2
Protein Name COP9 signalosome subunit 2
Synonyms ALIEN|CSN2|SGN2|TRIP15
Ortholog resources KEGG ortholog (KEGG orthology K12176) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087765 IRAL019G21 pDNR-LIB BC012629 NM_004236 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044573 ARe11H05 pKA1U5 NM_004236.3  
GCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGACTA
HKR279528 ARiS198N16 pGCAP10 NM_004236.3  
GCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGG
HKR331773 RBb29H05 pGCAP1 NM_004236.3  
AATGTGGTCTCCAATTTCTCCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATT
HKR345748 RBb64G04 pGCAP1 NM_004236.3  
GCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGA
HKR373235 RBd33B11 pGCAP10 NM_004236.3  
GCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGA
HKR384172 RBd60H04 pGCAP10 NM_004236.3  
GCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGA
HKR405800 RBdS014I08 pGCAP10 NM_004236.3  
CGGCCGGCCGATGCTCCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTG
HKR432443 RBdS081B19 pGCAP10 NM_004236.3  
GCCCCTCCCGGCCAAGATGTCTGACATGGAGGATGATTTCATGTGCGATGATGAGGAGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl