Prev. |  KEGG KO K04699 > 

RIKEN DNA Bank Human Resource - SOCS6

Gene ID NCBI Gene 9306 |  KEGG hsa:9306
Gene Symbol SOCS6
Protein Name suppressor of cytokine signaling 6
Synonyms CIS-4|CIS4|HSPC060|SOCS-4|SOCS-6|SOCS4|SSI4|STAI4|STATI4
Featured content Jak-STAT signaling pathway (human)
Ortholog resource in our bank

  SOCS6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010406 IRAK026A06 pCMV-SPORT6 BC020082 NM_004232 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE080815 M01C002A15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE080863 M01C002C15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE080911 M01C002E15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE080959 M01C002G15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE081007 M01C002I15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE081055 M01C002K15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE081103 M01C002M15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE081151 M01C002O15 pDONR221 04-134-2_1-E08 BC020082 NM_004232  
HGE088439 M01C021B15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088487 M01C021D15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088535 M01C021F15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088583 M01C021H15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088631 M01C021J15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088679 M01C021L15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088727 M01C021N15 pDONR221 IMS03-C08 BC020082 NM_004232  
HGE088775 M01C021P15 pDONR221 IMS03-C08 BC020082 NM_004232  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365323 RBd13F03 pGCAP10 NM_004232.3  
GGTGGACGCGGGGCGGCCCGCTCGGCTCCTCCGCACCCGCTCCCCGCTCGGGCCGAGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl