Prev. |  KEGG KO K02151 > 

RIKEN DNA Bank Human Resource - ATP6V1F

Gene ID NCBI Gene 9296 |  KEGG hsa:9296
Gene Symbol ATP6V1F
Protein Name ATPase H+ transporting V1 subunit F
Synonyms ATP6S14|VATF|Vma7
Ortholog resources KEGG ortholog (KEGG orthology K02151) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068006 ARe70A06 pKA1U5 NM_004231.2  
GCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGACGAGGACA
HKR077747 ARe94G03 pKA1U5 NM_004231.2  
ATCCTGGAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCA
HKR188128 ARi70F08 pGCAP10 NM_004231.2  
TTTTTTGGAAGGGTGGGGGTTGAGGCCGACGGGGCGCCGTACGGCGGAGGCGGGGTTTCA
HKR235342 ARiS088F22 pGCAP10 NM_004231.2  
GGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAG
HKR328403 RBb21A03 pKA1U5 NM_004231.2  
TTTGATGCTCGAAGGGTGGGGGTTGAGGCCGACGGGGCGCCGTACGGCGGAGGCGGGGTT
HKR340482 RBb51D10 pGCAP1 NM_004231.2  
TGTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCAT
HKR397305 RBd93E09 pGCAP10 NM_004231.2  
GAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCGCAGTGATCGGAGAC
HKR405237 RBdS013B13 pGCAP10 NM_004231.2  
GGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGGGGAGGGGTAAGCTCATCG
HKR442159 RBdS105G15 pGCAP10 NM_004231.2  
GGGGGTTTCAGTGGCTTCTGGTGCTCTAGGGTGAGCTCTGCCCGGCTGCAGGGATGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl