Prev. |  KEGG KO K12899 > 

RIKEN DNA Bank Human Resource - SRSF11

Gene ID NCBI Gene 9295 |  KEGG hsa:9295
Gene Symbol SRSF11
Protein Name serine and arginine rich splicing factor 11
Synonyms NET2|SFRS11|dJ677H15.2|p54
Ortholog resource in our bank

  SRSF11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX033729 IRAK084F09 pCMV-SPORT6 BC040436 NM_004768 Full/var
HGY084975 IRAL012H07 pOTB7 BC002784 NM_004768 Partial/var
HGY090040 IRAL025B16 pOTB7 BC009840 NM_004768 Partial/var
HGY095977 IRAL039P17 pOTB7 BC017359 NM_004768 Partial/var
HGY096932 IRAL042F12 pOTB7 BC022815 NM_004768 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE043451 W01A108K11 pENTR-TOPO IRAK084F09 BC040436 NM_004768  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235265 ARiS088C17 pGCAP10 NM_004768.2  
GGAAGCCTTTTCCGTTGCCGGTGCCGGCCTAGCGTCCTGGAATTACTTCAATCAAGAGCG
HKR249043 ARiS122K03 pGCAP10 NM_004768.2  
GGAAACGGCGGCGGCGGCGGCGGCATCGGCAGCAGTAGCAGAGGCTGTAGCATCGGACAC
HKR321674 RBb04D02 pKA1U5 NM_004768.2  
GACGGCGGCGGCGGCGGCGGCATCGGCAGCAGCNAGNTNAGGCTGTAGCATCGGACACCC
HKR326006 RBb15A06 pKA1U5 NM_004768.2  
CTCCGTTGCCGGTGCCGGCCTAGCGTCCTGGAATTACTTCAATCAAGAGCGAGAACCCGA
HKR326029 RBb15B05 pKA1U5 NM_004768.2  
GAGAAACGGCGGCGGCGGCGGCGGCATCGGCAGCAGTAGCAGAGGCTGTAGCATCGGACA
HKR416382 RBdS040P22 pGCAP10 NM_004768.2  
GCCCGTTTGTTTTCTCGTGGTCTCGAGCTCGCGCGCTCTCATCCCCTCCCCCGCGGCGTG
HKR444378 RBdS110P18 pGCAP10 NM_004768.2  
GGGGGCGGAGAAACGGCGGCGGCGGCGGCGGCATCGGCAGCAGTAGCAGAGGCTGTAGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl