Prev. |  KEGG KO K14768 > 

RIKEN DNA Bank Human Resource - WDR46

Gene ID NCBI Gene 9277 |  KEGG hsa:9277
Gene Symbol WDR46
Protein Name WD repeat domain 46
Synonyms BING4|C6orf11|FP221|UTP7
Ortholog resources KEGG ortholog (KEGG orthology K14768) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY080514 IRAL001E18 pOTB7 BC000388 NM_005452

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR051305 ARe28E09 pKA1U5 NM_005452.4  
GAGCAGCTGAGAGGAGTTTTGCACGTGGATCGCCGTTCGGGTGGGCGAGATGGAGACAGC
HKR380502 RBd51E06 pGCAP10 NM_005452.4  
GTCCGGGAGTTTTCAAGCCGACTGTGTGGCAGCTGAGAAGAGTTTTGCACGTGGATCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl