Prev. |  KEGG KO K17302 > 

RIKEN DNA Bank Human Resource - COPB2

Gene ID NCBI Gene 9276 |  KEGG hsa:9276
Gene Symbol COPB2
Protein Name COPI coat complex subunit beta 2
Synonyms MCPH19|beta'-COP
Ortholog resource in our bank

  COPB2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080565 IRAL001G21 pOTB7 BC000326 NM_004766 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE099616 M01C049A16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099664 M01C049C16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099712 M01C049E16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099760 M01C049G16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099808 M01C049I16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099856 M01C049K16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099904 M01C049M16 pDONR221 MGC14-B08 BC000326 NM_004766  
HGE099952 M01C049O16 pDONR221 MGC14-B08 BC000326 NM_004766  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR264529 ARiS161F09 pGCAP10 NM_004766.2  
AAAACNAGGGTTCCCGGGATTGNACCGACGCAGCCATGCTGGGCATGGTAGCATGCGCCT
HKR277712 ARiS194E16 pGCAP10 NM_004766.2  
GTCCACGTCNGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAG
HKR347608 RBb69A08 pGCAP1 NM_004766.2  
GCAGTCAGTCTGACGGTCAGTGGATCGGTGGGTTTATCTCAAGGCCTGAGTAGCCGGTAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl