Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CYTH1

Gene ID (NCBI) 9267
Gene Symbol CYTH1
Protein Name cytohesin 1
Synonyms B2-1|CYTOHESIN-1|D17S811E|PSCD1|SEC7
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Endocytosis (human)


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011567 IRAK028P07 pCMV-SPORT6 BC038385 NM_017456 Full/var
HGX039414 IRAK098I22 pCMV-SPORT6 BC050452 NM_017456 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE095217 M01C038A17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095265 M01C038C17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095313 M01C038E17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095361 M01C038G17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095409 M01C038I17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095457 M01C038K17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095505 M01C038M17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095553 M01C038O17 pDONR221 MGC08-E09 BC050452 ENST00000262763  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR365659 RBd14C11 pGCAP10 NM_004762.2  
GACGCGAGCGGCGAGCCGGAGCGCGGAGCCCGGCTCCCGCACCATGGAGGAGGACGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.10.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_161013.pl