Prev. |  KEGG KO K18441 > 

RIKEN DNA Bank Human Resource - CYTH1

Gene ID NCBI Gene 9267 |  KEGG hsa:9267
Gene Symbol CYTH1
Protein Name cytohesin 1
Synonyms B2-1|CYTOHESIN-1|D17S811E|PSCD1|SEC7
Featured content Endocytosis (human)
Ortholog resource in our bank

  CYTH1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX011567 IRAK028P07 pCMV-SPORT6 BC038385 NM_017456 Full/var
HGX039414 IRAK098I22 pCMV-SPORT6 BC050452 NM_017456 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE095217 M01C038A17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095265 M01C038C17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095313 M01C038E17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095361 M01C038G17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095409 M01C038I17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095457 M01C038K17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095505 M01C038M17 pDONR221 MGC08-E09 BC050452 ENST00000262763  
HGE095553 M01C038O17 pDONR221 MGC08-E09 BC050452 ENST00000262763  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR365659 RBd14C11 pGCAP10 NM_004762.2  
GACGCGAGCGGCGAGCCGGAGCGCGGAGCCCGGCTCCCGCACCATGGAGGAGGACGACAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl