Prev. |  KEGG KO K18441 > 

RIKEN DNA Bank Human Resource - CYTH2

Gene ID NCBI Gene 9266 |  KEGG hsa:9266
Gene Symbol CYTH2
Protein Name cytohesin 2
Synonyms ARNO|CTS18|CTS18.1|PSCD2|PSCD2L|SEC7L|Sec7p-L|Sec7p-like|cytohesin-2
Featured content Endocytosis (human)
Ortholog resource in our bank

  CYTH2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY029802 IRAK074I10 pBluescriptR BC038713 NM_017457 Full/var
HGY083295 IRAL008D23 pOTB7 BC004361 NM_017457 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006443 W01A016B19 pENTR-TOPO IRAK074I10 BC038713 NM_017457  
HGE006447 W01A016B23 pENTR-TOPO IRAK074I10 BC038713 NM_017457  
HGE006489 W01A016D17 pENTR-TOPO IRAL008D23 BC004361 NM_017457  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR046059 ARe15C11 pKA1U5 NM_017457.3  
GTGGGGCGACGAAGGGAAGAGTCTTTTCAGCGCTGAGGACTGGCGCTGAGGAGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl