Prev. |  KEGG KO K06635 > 

RIKEN DNA Bank Human Resource - PTTG1

Gene ID NCBI Gene 9232 |  KEGG hsa:9232
Gene Symbol PTTG1
Protein Name PTTG1 regulator of sister chromatid separation, securin
Synonyms EAP1|HPTTG|PTTG|TUTR1
Ortholog resources KEGG ortholog (KEGG orthology K06635) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB07329 pGL4-phPTTG1 Promoter collection, Human PTTG1 promoter

RDB_org_190226.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR044853 ARe12C05 pKA1U5 NM_004219.2  
ATCCTGGAAAACCAGGAGTGCGCCGCGTCCGTTCACCGCGGCCTCAGATGAATGCGGCTG
HKR078906 ARe97E10 pKA1U5 NM_004219.2  
GACCGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCT
HKR205319 ARiS013E23 pGCAP10 NM_004219.2  
GGCGGCCTCAGATGANTGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGAT
HKR219835 ARiS049J19 pGCAP10 NM_004219.2  
GGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTTGATAAGGAA
HKR247525 ARiS118N13 pGCAP10 NM_004219.2  
GAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTTG
HKR276516 ARiS191E20 pGCAP10 NM_004219.2  
GGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGAT
HKR326459 RBb16C11 pKA1U5 NM_004219.2  
GGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTTGATAAGGAAAATGGA
HKR344151 RBb60G07 pGCAP1 NM_004219.2  
TTTTGTCCGTTTTCCCCTTCCTACCTTGCTCCTTTTTGAATGGTCACTCTGATTTATGTT
HKR381698 RBd54E02 pGCAP10 NM_004219.2  
GGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGAT
HKR388852 RBd72C04 pGCAP10 NM_004219.2  
GGCTGAAGCTGGGGCTGGGGTTGGGGGACTGCCCGGGGCTTAGATGGCTCCGAGCCCGTT
HKR428166 RBdS070G22 pGCAP10 NM_004219.2  
GATGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTCTGATCTATGTT
HKR470806 RBdS177A06 pGCAP10 NM_004219.2  
TGACCGCGGCCTCAGATGAATGCGGCTGTTAAGACCTGCAATAATCCAGAATGGCTACTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl