Prev. | Human A to Z list > R > 

RIKEN DNA Bank Human Resource - RAB11B

Gene ID (NCBI) 9230
Gene Symbol RAB11B
Protein Name RAB11B, member RAS oncogene family
Synonyms H-YPT3
Databases KEGG hsa:9230 |  NCBI Gene 9230
Featured content Endocytosis (human)
Featured content Rab Family - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K07905)


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072850 ARe82C02 pKA1U5 NM_004218.3 done
GGGAGTCGCCGATCCCGCCGGAAGCGCCAGGACAATGGGGACCCGGGACGACGAGTACGA
HKR205402 ARiS013I10 pGCAP10 NM_004218.3  
GGGGGCTGCGGAGTCNCCGATCCCGCCGGAAGCGCCAGGACAATGGGGACCCGGGACGAC
HKR208028 ARiS020B04 pGCAP10 NM_004218.3  
GGTCGGGTGTTTGTGGTGGGGCTGCGGAGTCGCCGATCCCGCCGGAAGCGCCAGGACAAT
HKR366011 RBd15A11 pGCAP10 NM_004218.3  
GGCCCCCGTCGGGTGTTTGTGGTGGGGCTGCGGAGTCGCCGATCCCGCCGGAAGCGCCAG
HKR406068 RBdS015C20 pGCAP10 NM_004218.3  
GGCCCCCGTCGGGTGTTTGTGGTGGGGCTGCGGAGTCNCCGATCCCGCCGGAAGCGCCAN

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.03.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190131.pl