Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AURKB

Gene ID (NCBI) 9212
Gene Symbol AURKB
Protein Name aurora kinase B
Synonyms AIK2|AIM-1|AIM1|ARK2|AurB|IPL1|PPP1R48|STK12|STK5|aurkb-sv1|aurkb-sv2
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K11479)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY080485 IRAL001D13 pOTB7 BC000442 NM_004217 Full/var
HGY084285 IRAL010L21 pOTB7 BC013300 NM_004217 Full/var
HGY085889 IRAL014M01 pOTB7 BC009751 NM_004217 Full
HGY103602 IRAL059A02 pOTB7 BC080581 NM_004217 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR208294 ARiS020M06 pGCAP10 NM_004217.2  
TGAGATTCAGTTGTTTGCGGGCGGCCGGGAGAGTAGCAGTGCCTTGGACCCCAGCTCTCC
HKR388402 RBd71A02 pGCAP10 NM_004217.2  
GGGCCAGGGCGCGGCGTGGCAGATTCAGTTGTTTGCGGGCGGCCGGGAGAGTAGCAGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl