Prev. |  KEGG KO K11479 > 

RIKEN DNA Bank Human Resource - AURKB

Gene ID NCBI Gene 9212 |  KEGG hsa:9212
Gene Symbol AURKB
Protein Name aurora kinase B
Synonyms AIK2|AIM-1|AIM1|ARK-2|ARK2|AurB|IPL1|PPP1R48|STK-1|STK12|STK5|aurkb-sv1|aurkb-sv2
Ortholog resource in our bank

  AURKB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080485 IRAL001D13 pOTB7 BC000442 NM_004217 Full/var
HGY084285 IRAL010L21 pOTB7 BC013300 NM_004217 Full/var
HGY085889 IRAL014M01 pOTB7 BC009751 NM_004217 Full
HGY103602 IRAL059A02 pOTB7 BC080581 NM_004217 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR208294 ARiS020M06 pGCAP10 NM_004217.2  
TGAGATTCAGTTGTTTGCGGGCGGCCGGGAGAGTAGCAGTGCCTTGGACCCCAGCTCTCC
HKR388402 RBd71A02 pGCAP10 NM_004217.2  
GGGCCAGGGCGCGGCGTGGCAGATTCAGTTGTTTGCGGGCGGCCGGGAGAGTAGCAGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl