Prev. |  KEGG KO K16911 > 

RIKEN DNA Bank Human Resource - DDX21

Gene ID NCBI Gene 9188 |  KEGG hsa:9188
Gene Symbol DDX21
Protein Name DExD-box helicase 21
Synonyms GUA|GURDB|RH-II/GU|RH-II/GuA
Ortholog resource in our bank

  DDX21

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04927 SEREX clone NGO-Pr-26 (ID 629) #1 SEREX clone NGO-Pr-26 (ID 629) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081275 IRAL003D03 pOTB7 BC008071 NM_004728 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE025969 W01A064P09 pENTR-TOPO IRAL003D03 BC008071 NM_004728  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2022Apr03.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR374971 RBd37H03 pGCAP10 NM_004728.2  
GCTCTTCCTCTCCACGCGGTTGAGAAGACCGGTCGGCCTGGGCAACCTGCGCTGAAGATG
HKR395745 RBd89G01 pGCAP10 NM_004728.2  
GACGCGGTTGAGAAGACCGGTCGGCCTGGGCAACCTGCGCTGAAGATGCCGGGAAAACTC
HKR432511 RBdS081E15 pGCAP10 NM_004728.2  
GCTCTTCCTCTCCACGCGGTTGAGAAGACCGGTCGGCCTGGGCAACCTGCGCTGAAGATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.05.19

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl