Prev. |  KEGG KO K02180 > 

RIKEN DNA Bank Human Resource - BUB3

Gene ID NCBI Gene 9184 |  KEGG hsa:9184
Gene Symbol BUB3
Protein Name BUB3, mitotic checkpoint protein
Synonyms BUB3L|hBUB3
Ortholog resources KEGG ortholog (KEGG orthology K02180) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082999 IRAL007I07 pOTB7 BC005138 NM_004725 Full
HGY094294 IRAL035M06 pDNR-LIB BC022438 NM_004725 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE005883 W01A014L19 pENTR-TOPO IRAL007I07 BC005138 NM_004725  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR186408 ARi66A08 pGCAP10 NM_001007793.2  
GGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAAACGTTGCTTCT
HKR238498 ARiS096E02 pGCAP10 NM_001007793.2  
GGGCGAGTAGTGGAAACGTTGCTTCTGAGGGGAGCCCAAGATGACCGGTTCTAACGAGTT
HKR248846 ARiS122B22 pGCAP10 NM_001007793.2  
GAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAAA
HKR277686 ARiS194D14 pGCAP10 NM_001007793.2  
GAGGNNNNGNCGGCCTCAGCGAGTGGCGAGTAGTGGAAACGTTGCTTCTGAGGGGAGCCC
HKR279458 ARiS198K18 pGCAP10 NM_001007793.2  
GAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAAACGTTGCTTCTGAGGGGAGCCC
HKR367302 RBd18E06 pGCAP10 NM_001007793.2  
GGAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAA
HKR370905 RBd27E09 pGCAP10 NM_001007793.2  
GGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAAAC
HKR405969 RBdS014P09 pGCAP10 NM_001007793.2  
GGCCTAGCCTGCGAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGC
HKR428364 RBdS070P04 pGCAP10 NM_001007793.2  
GGAGTGTTCTGAGGGAANCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAA
HKR442223 RBdS105J07 pGCAP10 NM_001007793.2  
GGCCTAGCCTGCGAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGC
HKR453167 RBdS132P07 pGCAP10 NM_001007793.2  
GGAGTGTTCTGAGGGAAGCAAGGAGGCGGCGGCGGCCGCAGCGAGTGGCGAGTAGTGGAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl