DNA Bank Top |  KEGG KO K11578 > 

RIKEN DNA Bank Human Resource - ZW10

Gene ID NCBI Gene 9183 |  KEGG hsa:9183
Gene Symbol ZW10
Protein Name zw10 kinetochore protein
Synonyms HZW10|KNTC1AP

Link

Ortholog resource in our bank

  ZW10


External database

human ZW10

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB03886 SEREX clone NGO-St-140 (ID 1357) #1 SEREX clone NGO-St-140 (ID 1357) #1    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR170906 ARi27E10 pGCAP10 NM_004724.2  
GCCCAGTCAGCGTTGGTTCCCGTCTTGGCCATGGCCTCGTTCGTGACAGAAGTTTTGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


2024.09.27

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl