Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ARHGEF2

Gene ID (NCBI) 9181
Gene Symbol ARHGEF2
Protein Name Rho/Rac guanine nucleotide exchange factor (GEF) 2
Synonyms GEF|GEF-H1|GEFH1|LFP40|P40
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K12791)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008072 IRAK020C24 pCMV-SPORT6 BC020567 NM_004723 Full/var
HGY093254 IRAL033C06 pOTB7 BC027722 NM_004723 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092040 M01C030B16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092088 M01C030D16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092136 M01C030F16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092184 M01C030H16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092232 M01C030J16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092280 M01C030L16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092328 M01C030N16 pDONR221 MGC04-H08 BC020567 NM_004723  
HGE092376 M01C030P16 pDONR221 MGC04-H08 BC020567 NM_004723  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR065345 ARe63G01 pKA1U5 NM_004723.3  
GGCCCACATCCAGGAAGTCCTAGGAGCTGCAGCCAGCTGGAAGGACATTCAGGTACCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.25

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl