Prev. |  KEGG KO K02270 > 

RIKEN DNA Bank Human Resource - COX7A2L

Gene ID NCBI Gene 9167 |  KEGG hsa:9167
Gene Symbol COX7A2L
Protein Name cytochrome c oxidase subunit 7A2 like
Synonyms COX7AR|COX7RP|EB1|SIG81
Ortholog resources KEGG ortholog (KEGG orthology K02270) in the DNA Bank
Featured content Parkinson disease - human
Featured content Huntington disease - human
Featured content Alzheimer disease - human
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY086481 IRAL016D09 pDNR-LIB BC005251 NM_004718 Full
HGY088700 IRAL021M12 pDNR-LIB BC007095 NM_004718 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR071377 ARe78H09 pKA1U5 NM_004718.2  
GGGACTCTGGGCGTCATGTACTACAAGTTTAGTGGCTTCACGCAGAAGTTGGCAGGAGCA
HKR076829 ARe92B05 pKA1U5 NM_004718.2  
GCCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATG
HKR170932 ARi27F12 pGCAP10 NM_004718.2  
GGTCCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCA
HKR180826 ARi52B02 pGCAP10 NM_004718.2  
GCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGT
HKR184150 ARi60G06 pGCAP10 NM_004718.2  
GCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGT
HKR205395 ARiS013I03 pGCAP10 NM_004718.2  
GCTTCTCTGGGGCGGNCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGT
HKR219642 ARiS049B18 pGCAP10 NM_004718.2  
GGCCGGGGAGGCGGGGTCCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCG
HKR277711 ARiS194E15 pGCAP10 NM_004718.2  
GGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACTACAA
HKR321305 RBb03E09 pKA1U5 NM_004718.2  
GCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGT
HKR344812 RBb62A12 pGCAP1 NM_004718.2  
HKR372522 RBd31F02 pGCAP10 NM_004718.2  
GCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACT
HKR386177 RBd65H09 pGCAP10 NM_004718.2  
GGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATGTACTACAAG
HKR428099 RBdS070E03 pGCAP10 NM_004718.2  
GCCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCATG
HKR428346 RBdS070O10 pGCAP10 NM_004718.2  
GGTCCTTCTCTGGGGCGGTCGCGTTGGCAGCGGATGCGGGAAGCCGGACTCTGGGCGTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2019.05.17

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_190501.pl