Prev. | 

RIKEN DNA Bank Human Resource - FIBP

Gene ID NCBI Gene 9158 |  KEGG hsa:9158
Gene Symbol FIBP
Protein Name FGF1 intracellular binding protein
Synonyms FGFIBP|FIBP-1|TROFAS
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083111 IRAL007M23 pOTB7 BC014388 NM_004214 Full
HGY089329 IRAL023F09 pOTB7 BC017448 NM_004214 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE024954 W01A062G10 pENTR-TOPO IRAL007M23 BC014388 NM_004214  
HGE024960 W01A062G16 pENTR-TOPO IRAL007M23 BC014388 NM_004214  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044500 ARe11E04 pKA1U5 NM_004214.4  
GGAGCTGGACATCTTCGTGGGGAACACGACCCTTATCGACGAGGACGTGTATCGCCTCTG
HKR405304 RBdS013E08 pGCAP10 NM_004214.4  
GAGTCCCGAGCAGTGCTCGCTCCTGCTCGGGGCGCTGCGGCCCCGGGCGTCGCCATGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl