Prev. |  KEGG KO K12182 > 

RIKEN DNA Bank Human Resource - HGS

Gene ID NCBI Gene 9146 |  KEGG hsa:9146
Gene Symbol HGS
Protein Name hepatocyte growth factor-regulated tyrosine kinase substrate
Synonyms HRS
Featured content Endocytosis (human)
Ortholog resource in our bank

  HGS

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY083562 IRAL008P02 pOTB7 BC003565 NM_004712

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE017846 W01A044K06 pENTR-TOPO IRAL008P02 BC003565 NM_004712  
HGE017850 W01A044K10 pENTR-TOPO IRAL008P02 BC003565 NM_004712  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR045307 ARe13E11 pKA1U5 NM_004712.3  
TTGGTAGCAGGGGAGCGCCCGCGGCGTCGGGTTTGGGCTGGAGGTCGCCATGGGGCGAGG
HKR082049 ARf05C01 pKA1U5 NM_004712.3  
GGGAAGCGGAAGTCGGGGGGCGCGCCAGCTCGTAGCAGGGGAGCGCCCGCGGCGTCGGGT
HKR243885 ARiS109L21 pGCAP10 NM_004712.3  
GAAAAGGCGGAAGCGGAAGTCGGGGGGCGCGCCAGCTCGTAGCAGGGGAGCGCCCGCGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl