Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATG12

Gene ID (NCBI) 9140
Gene Symbol ATG12
Protein Name autophagy related 12
Synonyms APG12|APG12L|FBR93|HAPG12
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Autophagy (human)
Featured content Ortholog resources in the DNA Bank (KEGG orthology K08336)


Genome Network Project (GNP) Human cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX008615 IRAK021I23 pCMV-SPORT6 BC012266 NM_004707 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238725 ARiS096N13 pGCAP10 NM_004707.2  
GGANTGTCTCCAAGCAAGATGGCGGAGGAGCCGCAGTCTGTGTTGCAGCTTCCTACTTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.06.01

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl