Prev. |  KEGG KO K12330 > 

RIKEN DNA Bank Human Resource - ARHGEF1

Gene ID NCBI Gene 9138 |  KEGG hsa:9138
Gene Symbol ARHGEF1
Protein Name Rho guanine nucleotide exchange factor 1
Synonyms GEF1|IMD62|LBCL2|LSC|P115-RHOGEF|SUB1.5
Ortholog resource in our bank

  ARHGEF1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008019 IRAK020A19 pCMV-SPORT6 BC034013 NM_199002 Full
HGX055727 IRAK139F07 pCMV-SPORT6 BC064996 NM_198977 Full/var
HGX056609 IRAK141I17 pCMV-SPORT6 BC067262 NM_199002 Full/var
HGY084421 IRAL011A21 pOTB7 BC005155 NM_199002 Partial
HGY091127 IRAL027N15 pOTB7 BC011726 NM_198977 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE020754 W01A051O18 pENTR-TOPO IRAK020A19 BC034013 NM_199002  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR074484 ARe86D12 pKA1U5 NM_004706.3  
GAGAGCCAGGAAGCGGGAGCCGGGACCCAGGGCCCGGGATCGCCGAGCCCGACCTCGGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl