DNA Bank Top |  KEGG KO K05868 > 

RIKEN DNA Bank Human Resource - CCNB2

Gene ID NCBI Gene 9133 |  KEGG hsa:9133
Gene Symbol CCNB2
Protein Name cyclin B2
Synonyms HsT17299
Featured content DNA damage

Link

Ortholog resource in our bank

  CCNB2


External database

human CCNB2

Individualy Deposited Resource

Catalog number Name of Resource Description CDS comparison
Refered (NCBI mRNA) CDS status(1)
RDB06415 pCMFlag_hsCCNB2 Expression vector of human CCNB2.    
RDB05448 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)    
RDB05447 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)    
RDB05430 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)    
RDB05425 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)    
RDB05424 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)    
RDB05367 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)    
RDB05366 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)    
RDB04098 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)    
RDB03515 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)    

(1) CDS status was determined by comparing the plasmid sequence with NCBI RefSeq mRNA.

webcatalog20240727.tab


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006744 W01A016O08 pENTR-TOPO flj0033m22 AK001404 NM_004701  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2024May11.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR178974 ARi47H06 pGCAP10 NM_004701.2  
CGGCCGGCCGATGGAAGATCCCCAGCGCTGCGGGCTCGGAGAGCAGTCCTAACGGCGC
HKR336148 RBb40G04 pGCAP1 NM_004701.2  
ATTTGAATCCTGGAACAAGGCTACAGCGTCGAAGATCCCCAGCGCTGCGGGCTCGGAGAG
HKR379702 RBd49E06 pGCAP10 NM_004701.2  
GGAGCAGTCCTAACGGCGCCTCGTACGCTAGTGTCCTCCCTTTTCAGTCCGCGTCCCTCC
HKR384906 RBd62E10 pGCAP10 NM_004701.2  
GGAAGATCCCCAGCGCTGCGGGCTCGGAGAGCAGTCCTAACGGCGCCTCGTACGCTAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2024May11.csv
NRCDhumcloneList_RB_2024May11.csv


No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
Visualization of Organelles update (Dec 18, 2023)
Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
Autophagy and Mitophagy Updates (Aug 16, 2023)
High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
Dnaconda's recommendation BRC Resource News RIKEN BRC 20th RIKEN BRC News sign-up

2024.09.29

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_240727.pl