Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - CCNB2

Gene ID (NCBI) 9133
Gene Symbol CCNB2
Protein Name cyclin B2
Synonyms HsT17299
Databases KEGG hsa:9133 |  NCBI Gene 9133
Featured content DNA damage
Featured content Ortholog resources in the DNA Bank (KEGG orthology K05868)


Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04098 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)
RDB03515 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)
RDB05366 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)
RDB05367 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)
RDB05424 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)
RDB05425 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)
RDB05430 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)
RDB05447 pAxCALNLhCCNB2 (forward) Shuttle vector to generate rAd harboring human CCNB2 (forward)
RDB05448 pAxCALNLhCCNB2 (reverse) Shuttle vector to generate rAd harboring human CCNB2 (reverse)
RDB06415 pCMFlag_hsCCNB2 Expression vector of human CCNB2

RDB_org_170226.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006744 W01A016O08 pENTR-TOPO flj0033m22 AK001404 NM_004701  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR178974 ARi47H06 pGCAP10 NM_004701.2  
CGGCCGGCCGATGGAAGATCCCCAGCGCTGCGGGCTCGGAGAGCAGTCCTAACGGCGC
HKR336148 RBb40G04 pGCAP1 NM_004701.2  
ATTTGAATCCTGGAACAAGGCTACAGCGTCGAAGATCCCCAGCGCTGCGGGCTCGGAGAG
HKR379702 RBd49E06 pGCAP10 NM_004701.2  
GGAGCAGTCCTAACGGCGCCTCGTACGCTAGTGTCCTCCCTTTTCAGTCCGCGTCCCTCC
HKR384906 RBd62E10 pGCAP10 NM_004701.2  
GGAAGATCCCCAGCGCTGCGGGCTCGGAGAGCAGTCCTAACGGCGCCTCGTACGCTAGTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl