Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AIFM1

Gene ID (NCBI) 9131
Gene Symbol AIFM1
Protein Name apoptosis inducing factor mitochondria associated 1
Synonyms AIF|CMT2D|CMTX4|COWCK|COXPD6|DFNX5|NADMR|NAMSD|PDCD8
Databases KEGG hsa:9131 |  NCBI Gene 9131
Featured content Apoptosis - human
Featured content Ortholog resources in the DNA Bank (KEGG orthology K04727)


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE022863 W01A057C15 pENTR-TOPO flj0066l15 AK000775 NM_004208  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR340433 RBb51B09 pGCAP1 NM_004208.2  
ATGGTGGTTCCCCTTCCCCGGCTCTAGCAGGCCGGCTTCTCTGTCCAATGCCCACCCGGA
HKR363697 RBd09E01 pGCAP10 NM_004208.2  
GACTGGGGGAGCTGGCCGGGGCTCACGGTGTTTGACCCGTCGGTCGTGCGTGAGAGGAAA
HKR383232 RBd58B08 pGCAP10 NM_004208.2  
GGGTCGTGCGTGAGAGGAAAGGGAAGGAGGAGGTCCCGAATANNNNNCGCCGAAATGTTC
HKR428290 RBdS070M02 pGCAP10 NM_004208.2  
GNNCCTTCCCCTTCCCCNGNTCNNNNNTGCCNGCTNNNNTNNNCNATGCCCACCCGGANN
HKR430177 RBdS075H09 pGCAP10 NM_004208.2  
GTTTTTGACCCGTCGGTCGTGCGTGAGAGGAAAGGGAAGGAGGAGGTCCCGAATAGCGGT
HKR453149 RBdS132O13 pGCAP10 NM_004208.2  
GGTCGGTCGTGCGTGAGAGGAAAGGGAAGGAGGAGGTCCCGAATAGCGGTCGCCGAAATG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2018.05.24

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_180123.pl