Prev. |  KEGG KO K13119 > 

RIKEN DNA Bank Human Resource - FAM50A

Gene ID NCBI Gene 9130 |  KEGG hsa:9130
Gene Symbol FAM50A
Protein Name family with sequence similarity 50 member A
Synonyms 9F|DXS9928E|HXC-26|HXC26|MRXSA|XAP5
Ortholog resource in our bank

  FAM50A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Individualy Deposited Resource

Catalog number Name of Resource Description
RDB04625 SEREX clone NGO-Br-10 (ID 854, 853) #1 SEREX clone NGO-Br-10 (ID 854, 853) #1

webcatalog20220516.tab

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX008248 IRAK020K08 pCMV-SPORT6 BC015499 NM_004699 Partial
HGY082975 IRAL007H07 pOTB7 BC000028 NM_004699 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Jun29.csv
GNP_full_IRAL_2023Jun29.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR072524 ARe81F04 pKA1U5 NM_004699.1  
GGCTGCCGCTGTCGCCGTCGCCGCCGCCGCCGCCCGCCGCCGCCGCCGCCGCCGCCGCCG
HKR386402 RBd66A02 pGCAP10 NM_004699.1  
GGTTCGGNCGCCACCGCCGCTGCCGCTGCCGCTGTCGCTGTCGCCGCCGCCGCCGCCCGC
HKR389609 RBd74A09 pGCAP10 NM_004699.1  
GGCCGCCGCCGCCCGCCGCCGCCGCCGCCGCCGCCGCCGCTGCCATGGCTCAATACAAGG
HKR405619 RBdS014A19 pGCAP10 NM_004699.1  
GGACTGTTCGGCCGCCACCGCCGCTGCCGCTGCCGCTGTCGCTGTCGCCGCCGCCGCCGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.10.11

Homo_sapiens_gene_info230514.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl