Prev. |  KEGG KO K05221 > 

RIKEN DNA Bank Human Resource - P2RX6

Gene ID NCBI Gene 9127 |  KEGG hsa:9127
Gene Symbol P2RX6
Protein Name purinergic receptor P2X 6
Synonyms P2RXL1|P2X6|P2XM
Ortholog resource in our bank

  P2RX6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX020691 IRAK051M03 pCMV-SPORT6 BC033488 NM_005446 Full
HGX053939 IRAK134O03 pCMV-SPORT6 BC063553 NM_005446 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182482 ARi56D10 pGCAP10 NM_005446.3  
GATGTGCCCGCAGCTAGCAGGAGCTGGCAGCATGGGCTCCCCAGGGGCTACGACAGGCTG
HKR183225 ARi58B01 pGCAP10 NM_005446.3  
GATGTGCCCGCAGCTAGCAGGAACTGGCAGCATGGGCTCCCCAGGGGCTACGACAGGCTG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl