Prev. |  KEGG KO K12606 > 

RIKEN DNA Bank Human Resource - CNOT9

Gene ID NCBI Gene 9125 |  KEGG hsa:9125
Gene Symbol CNOT9
Protein Name CCR4-NOT transcription complex subunit 9
Synonyms CAF40|CT129|RCD-1|RCD1|RQCD1
Ortholog resource in our bank

  CNOT9

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY088570 IRAL021H02 pDNR-LIB BC007102 NM_005444 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR336126 RBb40F06 pGCAP1 NM_005444.1  
GGGACGCGTCCGGCTGTGGAAGAGAGCGGCGGCCGCTCACAACATGCACAGCCTGGCGAC
HKR342478 RBb56D06 pGCAP1 NM_005444.1  
GGCCGGGACTGATCCATCTTTTCCCGCCGTTCACTGGCTTTTGGAGGAGGGTCAGAGTTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl