Prev. | 

RIKEN DNA Bank Human Resource - PDLIM1

Gene ID NCBI Gene 9124 |  KEGG hsa:9124
Gene Symbol PDLIM1
Protein Name PDZ and LIM domain 1
Synonyms CLIM1|CLP-36|CLP36|HEL-S-112|hCLIM1
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX001471 IRAK003L07 pCMV-SPORT6 BC000915 NM_020992
HGY096024 IRAL040A24 pOTB7 BC018755 NM_020992 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE001544 W01A003O08 pENTR-TOPO IRAK003L07 BC000915 NM_020992 done

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR068932 ARe72F12 pKA1U5 NM_020992.2  
GGTTGCCCTGCCCCCGCCAGCCCCAGGCTCCCCGGGTCCGCGCCGCGCCGCTCTTTCTCC
HKR076503 ARe91E07 pKA1U5 NM_020992.2  
GAGCCCCAGGCTCCCCGGGCCCGCGCCGCGCCGCTCTTTCTCCGACAGCCGCCGGGGGTG
HKR188151 ARi70G07 pGCAP10 NM_020992.2  
TGGCCCGCCCTGGCCCTCGCGGTTGCCCTGCCCCCGCCAGCCCCAGGCTCCCCGGGCCCG
HKR208224 ARiS020J08 pGCAP10 NM_020992.2  
GCTCTTTCTCCGACAGCCGCCGGGGGTGCCCTGCAAGCTGTTCCGCGCGTCCTGCCCGTC
HKR337230 RBb43B06 pGCAP1 NM_020992.2  
GGAGCCCCAGGCTCCCCGGGCCCGCGCCGCGCCGCTCTTTCTCCGACAGCCGCCGGGGGT
HKR363650 RBd09C02 pGCAP10 NM_020992.2  
GCCAGGCTCCCCGGGCCCGCGCCGCGCCGCTCTTTCTCCGACAGCCGCCGGGGGTGCCCT
HKR377249 RBd43C01 pGCAP10 NM_020992.2  
GGGCCTGGGCGGAGCCGCCCCCGCCCTGGCCCTCGCGGTTGCCCTGCCCCCGCCAGCCCC
HKR416177 RBdS040H09 pGCAP10 NM_020992.2  
GGCGCGGTTGCCCTGCCCCCGCCAGCCCCAGGCTCCCCGGGCCCGCGCCGCGCCGCTCTT
HKR453060 RBdS132K20 pGCAP10 NM_020992.2  
GGGAGGGAGGCGGTGTGGGGTCCCGGGCAGAGCTGCTGAGAGCCCCGGCCCCGCATCTGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl