Prev. |  KEGG KO K08520 > 

RIKEN DNA Bank Human Resource - SEC22C

Gene ID NCBI Gene 9117 |  KEGG hsa:9117
Gene Symbol SEC22C
Protein Name SEC22 homolog C, vesicle trafficking protein
Synonyms SEC22L3
Ortholog resource in our bank

  SEC22C

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001583 IRAK003P23 pCMV-SPORT6 BC018437 NM_004206 Full
HGY087572 IRAL018P12 pOTB7 BC006178 NM_032970 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR059375 ARe48H07 pKA1U5 NM_032970.2  
ATCCTGTGGGCTGCGCCTGGGCTGCCGGTGACCTGGGCCGAGCCCTCCCGGTCGGCTAAG
HKR208306 ARiS020M18 pGCAP10 NM_032970.2  
GGTTGTGTTGCTCTGTGTTCTTTTTGGCCGGGAGTGGTTATGTCCGTGTCCTACTGTTAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl