Prev. |  KEGG KO K11833 > 

RIKEN DNA Bank Human Resource - USP2

Gene ID NCBI Gene 9099 |  KEGG hsa:9099
Gene Symbol USP2
Protein Name ubiquitin specific peptidase 2
Synonyms UBP41|USP9
Ortholog resources KEGG ortholog (KEGG orthology K11833) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY030075 IRAK075D03 pBluescriptR BC041366 NM_171997 Partial/var
HGY083362 IRAL008G18 pOTB7 BC002955 NM_004205 Full/var
HGY085166 IRAL012P06 pOTB7 BC002854 NM_004205 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR370099 RBd25E03 pGCAP10 NM_004205.4  
GAGAGCCGGGACCCGGGCTGTTGGCGGCGCACGCCGGGGAGGTTGAGGCGGAGGAGCGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl