Prev. |  KEGG KO K03860 > 

RIKEN DNA Bank Human Resource - PIGQ

Gene ID NCBI Gene 9091 |  KEGG hsa:9091
Gene Symbol PIGQ
Protein Name phosphatidylinositol glycan anchor biosynthesis class Q
Synonyms GPI1|c407A10.1
Ortholog resources KEGG ortholog (KEGG orthology K03860) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087094 IRAL017M06 pOTB7 BC006377 NM_148920 Full
HGY090856 IRAL027C08 pOTB7 BC010094 NM_148920 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR384972 RBd62H04 pGCAP10 NM_004204.2  
TGGTGGAGGCAGCGAGCGCCGTCGTCTGCCCGGGCCCGCCCATCGGGGTCCCCAACCCCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl