Prev. |  KEGG KO K13872 > 

RIKEN DNA Bank Human Resource - SLC7A6

Gene ID NCBI Gene 9057 |  KEGG hsa:9057
Gene Symbol SLC7A6
Protein Name solute carrier family 7 member 6
Synonyms LAT-2|LAT3|y+LAT-2
Ortholog resource in our bank

  SLC7A6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024990 IRAK062H22 pCMV-SPORT6 BC028216 NM_003983 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE093624 M01C034A24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093672 M01C034C24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093720 M01C034E24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093768 M01C034G24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093816 M01C034I24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093864 M01C034K24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093912 M01C034M24 pDONR221 MGC06-F12 BC028216 ENST00000219343  
HGE093960 M01C034O24 pDONR221 MGC06-F12 BC028216 ENST00000219343  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR235570 ARiS088P10 pGCAP10 NM_003983.4  
CGGCCGCGGCGGCGGCGGCGCGACCGAGCATCCTGGCGGCGCCGGGCCACTGGGAGGTCT
HKR398036 RBd95B12 pGCAP10 NM_003983.4  
GGGCGCGACCGAGCATCCTGGCGGCGCCGGGCCACTGGGAGAGTTTATGTGGCCGAGGCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl