Prev. |  KEGG KO K16732 > 

RIKEN DNA Bank Human Resource - PRC1

Gene ID NCBI Gene 9055 |  KEGG hsa:9055
Gene Symbol PRC1
Protein Name protein regulator of cytokinesis 1
Synonyms ASE1
Ortholog resources KEGG ortholog (KEGG orthology K16732) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082871 IRAL007C23 pOTB7 BC005140 NM_199413 Full/var
HGY083888 IRAL009L24 pOTB7 BC003138 NM_003981 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE015694 W01A039D22 pENTR-TOPO IRAL007C23 BC005140 NM_199413  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR371769 RBd29H01 pGCAP10 NM_003981.2  
GGCGGAGCGGCTACGCGGAGTGACATCGCCGGTGTTTGCGGGTGGTTGTTGCTCTCGGGG
HKR381724 RBd54F04 pGCAP10 NM_003981.2  
GGCGCGGAGTGACATCGCCGGTGTTTGCGGGTGGTTGTTGCTCTCGGGGCCGTGTGGAGT
HKR388555 RBd71G11 pGCAP10 NM_003981.2  
TGGCGGGGCTCAACGGCTCGCGGAGCGGCTACGCGGAGTGACATCGCCGGTGTTTGCGGG
HKR396969 RBd92H01 pGCAP10 NM_003981.2  
GCCCGTGGCGCGGTTTGAAATTTTGCGGGGCTCAACGGCTCGCGGAGCGGCTACGCGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.07

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl